rs2403456 chr11:11156267 A>G
- Sequence
gctctgagctgagtctgtctccag[A/G]gattgccctcagatgagctctcag
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.30 | 1.17 | 1.37 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, body mass index (bmi), late onset alzheimers disease, systolic blood pressure (sbp)