rs240365 chr6:75204520 T>C
- Sequence
caatatatgttttaaaaaagaaaa[T/C]gctttctctcctttttagccaaaa
- ASB in cell types
- MS-1 (Small cell lung carcinoma) A549 (lung carcinoma) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -2.68 | 1.49 | 1.33 | |||
| A549 (lung carcinoma) | 0.74 | 0.56 | 1.01 | |||
| 2588 (Lymphoblastoid Cell Lines) | 0.67 | -0.34 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial