rs2407356 chr19:27394935 T>C
- Sequence
gcagattgcacaaaaacactgtat[T/C]ctaacttctcaaacaaaggaaagg
- ASB in cell types
- HeLa (cervical adenocarcinoma) HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- CENPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CENPA_HUMAN | -5.64 | 2.67 | 2.67 | n/a | n/a |
Items per page:
1 – 1 of 1