rs2407746 chr8:5080235 C>G
- Sequence
atggaataagcttctatggaggct[C/G]attataaaactcatgtagagtcta
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | -1.80 | 2.59 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1