rs2409840 chr21:36706253 C>T
- Sequence
ggaatgaggcgctggctccctttc[C/T]ctccatttctccctgggggtccca
- ASB in cell types
- epithelial cell of prostate VCaP (prostate carcinoma) GM19238 (female B-cells lymphoblastoid cell lines) GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.95 | 1.63 | 1.49 | n/a | No Hit |
Items per page:
1 – 1 of 1