rs2410267 chr8:15378745 G>A
- Sequence
taccagaagggggcgcccagcata[G/A]tttctgaaacagtaaatacaacag
- ASB in cell types
- MDM(monocyte derived macrophages) GM10847 (female B-cells Lymphoblastoid Cell Lines) ID00015 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -0.75 | 1.85 | 2.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.93 | 0.93 | 1.00 | |||
| ID00015 (lymphoblastoid cell) | -2.06 | 2.33 | 1.00 |
Items per page:
1 – 3 of 3