rs2410812 chr7:101290511 G>C
- Sequence
ttgcaactgccagctcccggggca[G/C]tggggctgcagtagctgcgggggg
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) IPSC-derived bipolar neuron HCT-116 (colon carcinoma)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.05 | -0.05 | 2.04 | n/a | No Hit | |||
| RAD21_HUMAN | 2.39 | -2.57 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Minor_Salivary_Gland, Pancreas, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Stomach