rs2410813 chr7:101290555 C>T
- Sequence
gggggcgtcttgagcttcagtccc[C/T]cgggatgttgtagatcccgtgctg
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) adrenal gland thyroid gland testis
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.27 | 0.89 | 1.79 | n/a | No Hit | |||
| STAG1_HUMAN | 2.48 | 0.85 | 1.14 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Liver, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid