rs2411822 chr14:65411677 A>G
- Sequence
aaaatgcccaagcctagagaaatg[A/G]ttcttgtcttaagggcaccatttc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.38 | 0.68 | 1.11 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biantennary nongalactosylated glycans, biantennary nongalactosylated glycans in women, body mass index (bmi), desialylated glycan peak 1, desialylated glycan peak 1 in women, glycan peak 1, glycan peak 1 in women, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid