rs241187 chr8:28787754 C>T
- Sequence
tacacagcaatctatttcatctaa[C/T]gacctgctgtctgcatctgcatca
- ASB in cell types
- foreskin keratinocyte neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.30 | 2.33 | |||
| neutrophils from periferal blood | 2.10 | -0.50 | 1.50 |
Items per page:
1 – 2 of 2