rs2411899 chr17:49192747 T>C
- Sequence
aagatgttttcatttcagggccgt[T/C]ctgggggtgtcagtgcgcacgcgc
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) tibial nerve GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CLOCK_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CLOCK_HUMAN | -4.79 | 2.70 | 2.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.23 | 1.03 | 1.23 | n/a | No Hit |
Items per page:
1 – 2 of 2