rs2412261 chr11:3581443 T>C
- Sequence
ccaggccctgcccctcctccccgc[T/C]gcagccaggttgcaccccgatggt
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) HeLa (cervical adenocarcinoma) IPSC-derived bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.71 | 0.08 | 1.67 | 0.08 | Weak Discordant | |||
| IKZF1_HUMAN | 2.65 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
