rs2413398 chr22:36334902 T>G
- Sequence
ccagccaggttgcagttaggaagc[T/G]aaagaggcagattcctgctctgtc
- ASB in cell types
- CD14+ monocytes MDM(monocyte derived macrophages)
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | -0.46 | 2.71 | 1.50 | 4.42 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP alzheimers disease, focal segmental glomerulosclerosis, late onset alzheimers disease, parkinsons disease, schizophrenia