rs2413907 chr15:48520910 G>T
- Sequence
ccgagcagctccatacttcacact[G/T]gggctacggcaggattaactcaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -2.66 | 2.57 | 1.00 | |||
| VCaP (prostate carcinoma) | -1.62 | 2.39 | 2.00 |
Items per page:
1 – 2 of 2