rs2414918 chr15:66835184 C>T
- Sequence
aatgcagctcctgctggctgcaaa[C/T]ccgcctgccatcaaacaggccctg
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | -2.52 | 1.32 | 1.33 | 4.06 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
