rs2416672 chr12:11433849 C>T
- Sequence
taagtgctttctggctctgtggac[C/T]tggcttctgctccagactttctca
- ASB in cell types
- Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 1.97 | -1.02 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, comorbid depressive syndrome and alcohol dependence, coronary artery disease (cad), cystatin c in serum, fasting blood glucose, hdl cholesterol, infant head circumference
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis