rs2416760 chr9:120612361 T>C
- Sequence
acctattgataactgatttttttt[T/C]ccctctaaaatgaaaagttagaga
- ASB in cell types
- foreskin keratinocyte HeLa (cervical adenocarcinoma) GM18526 (B – cells Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.32 | n/a | 2.67 | |||
| HeLa (cervical adenocarcinoma) | 1.79 | n/a | 5.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.50 | 1.66 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -0.74 | 1.15 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP college completion, height, ldl cholesterol, microalbuminuria, rheumatoid arthritis, systolic blood pressure (sbp), waist hip ratio