rs2417656 chr9:105881826 C>T
- Sequence
acctttttcagctttctgtctccc[C/T]taacagaggacctctgttttgaga
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma) KMS-11 (Plasma cell myeloma) prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.84 | n/a | 2.00 | |||
| PC9 (lung adenocarcinoma) | 1.12 | 0.80 | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | -1.19 | 1.70 | 1.50 | |||
| prostate gland | -1.69 | 2.09 | 1.00 |
Items per page:
1 – 4 of 4