rs2417811 chr12:19856498 A>T
- Sequence
gtgtcttgctcaagaggttacagt[A/T]tttttttgtgtgacgagcatggac
- ASB in cell types
- CHL-1 (Melanoma)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -0.49 | 1.77 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diastolic blood pressure (dbp), refractive error, systolic blood pressure (sbp)