rs2419061 chr2:59789684 G>A
- Sequence
gatcaattgattattaggagattt[G/A]caacctaacagtgtattatatccc
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.36 | -2.15 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -1.64 | 1.94 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, height, ldl cholesterol, microalbuminuria, systolic blood pressure (sbp), total cholesterol