rs2420287 chr10:116524400 A>C
- Sequence
ggagtctcatcccatacatagacc[A/C]aattataaagctggatttttgtgc
- ASB for transcription factors
- FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | 2.24 | -2.06 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, aortic valve calcium, neuroblastoma (brain cancer), rheumatoid arthritis, tardive dyskinesia, years of education