rs2420963 chr10:121781389 G>A
- Sequence
gtcacgtacacactcaagggcaga[G/A]gcattaacactcagtgcgatacca
- ASB in cell types
- HMLE-Twist-ER (breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMLE-Twist-ER (breast cancer) | -0.56 | 1.89 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, cystatin c in serum, hdl cholesterol, neuroticism
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid