rs2421049 chr5:159505178 C>A
- Sequence
ctagtgcccctcctaggtctgttc[C/A]ccagggcagtgactcatactctga
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.20 | -0.37 | 2.00 | -1.90 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP late onset alzheimers disease, longstanding arthritis, neuroblastoma (brain cancer), primary rhegmatogenous retinal detachment, total cholesterol change with statins, urinary albumin-to-creatinine ratio