rs2421050 chr5:159516036 T>C
- Sequence
cccgccgcctgcaggtgtcgctgg[T/C]ggctactgacccatctgctgcttg
- ASB in cell types
- Kelly (neuroblastoma) WA09 (embryonic stem cells) SYO-1(Biphasic synovial sarcoma) EOL-1 (Acute myeloid leukemia)
- ASB for transcription factors
- ITF2_HUMAN IRF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | n/a | 3.35 | 2.00 | -1.15 | Weak Discordant | |||
| IRF4_HUMAN | 1.88 | -1.12 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP chronic kidney disease, hypertension (early onset hypertension), stabilized warfarin dose, variant creutzfeldt-jakob disease