rs2422764 chr20:2387422 C>G
- Sequence
tcactgttgaacactggtcctgca[C/G]agtgctcactcaccacagcagggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) foreskin keratinocyte GM18526 (B – cells Lymphoblastoid Cell Lines) VCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.20 | 1.93 | 1.56 | 3.40 | Concordant | |||
| STAG1_HUMAN | -2.23 | 2.60 | 2.27 | n/a | n/a | |||
| TIF1B_HUMAN | 2.40 | -2.39 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, mitral annular calcium, obesity with early age of onset (age >2)