rs2422861 chr20:3218727 G>A
- Sequence
cgagtctgcgggagggtggtggga[G/A]gggcgccttggggccagagatatc
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 2.48 | -0.01 | 1.86 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.88 | 0.71 | 1.10 |
Items per page:
1 – 2 of 2