rs2423037 chr20:4814343 G>A
- Sequence
acaagctcagatttctttggtatc[G/A]acacttcctgtttactgagtggtt
- ASB in cell types
- MDM(monocyte derived macrophages) CD14+ monocytes
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.95 | 0.34 | 1.36 | -0.45 | Weak Concordant | |||
| STAT1_HUMAN | 2.54 | 0.48 | 2.33 | 0.04 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP birth weight, diastolic blood pressure (dbp), homa-b, lp-pla2 mass, parkinsons disease, systolic blood pressure (sbp)