rs2423333 chr20:7924971 T>C
- Sequence
ccaagcagttgtgtggttctaaac[T/C]cagggcctgtcatagtgaagtgtt
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) CD14+ monocytes
- ASB for transcription factors
- TCF21_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 1.52 | n/a | 2.50 | n/a | No Hit | |||
| STAT1_HUMAN | 2.07 | -1.15 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, college completion, serum creatinine, years of education