rs2423364 chr20:8536048 C>T
- Sequence
ttcaggcaccactaaacttgattt[C/T]cctttgactatcattttaaggaaa
- ASB in cell types
- MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.56 | 2.09 | 1.83 | -3.59 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, eye color, late onset alzheimers disease, schizophrenia, suicide attempts in major depressive disorder, suicide attempts in mood disorder patients