rs2424576 chr20:23630244 C>T
- Sequence
atgtgcagccaggctccccagtga[C/T]gccatgtacagccaagcttgagac
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- MAX_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAX_HUMAN | 1.74 | -1.13 | 1.00 | n/a | No Hit | |||
| CREB1_HUMAN | 1.91 | -0.64 | 1.25 | -4.29 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP cystatin c in serum, fasting blood glucose, hdl cholesterol change with statins, refractive error, serum cystatin c estimated glomerular filtration rate (egfr)
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Testis, Whole_Blood