rs2425460 chr20:40966320 G>T
- Sequence
ctgcacccaggcttggccttgagg[G/T]tcctctgcttgtctcaactctgca
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -1.31 | 1.98 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.40 | 1.25 | 1.39 | -1.94 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP arthritis including non-rheumatoid, biploar disorder (bipolar schizoaffective disorder), body mass index (bmi), ldl cholesterol, rheumatoid arthritis