rs2425618 chr20:43658165 C>T
- Sequence
gtgtcttagagatctaaattatcc[C/T]cctttgcaattgcatacctaaaga
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -1.90 | 3.17 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.24 | 1.28 | 1.11 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 2.48 | -0.43 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 2.22 | -2.35 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.04 | 0.94 | 2.04 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood