rs2426608 chr20:56298412 G>T
- Sequence
tattatcctcaggacacagagggg[G/T]aagctgaggcttagaaaaaggaag
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.40 | 0.08 | 1.62 | -3.83 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), fasting blood glucose, height, total cholesterol change with statins