rs2427482 chr20:63009168 C>T
- Sequence
ccgggtgaggcccctgctgcggcc[C/T]ctgcgggaccagccacgaattccg
- ASB in cell types
- foreskin keratinocyte HepG2 (hepatoblastoma) NB69 (neuroblastoma) HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.98 | n/a | 2.33 | |||
| HepG2 (hepatoblastoma) | 0.31 | 0.87 | 1.12 | |||
| NB69 (neuroblastoma) | -2.99 | 1.88 | 1.50 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -1.05 | 2.11 | 2.00 |
Items per page:
1 – 4 of 4