rs2428176 chr6:110484528 A>G
- Sequence
tttgcacaatgacaaaattgccta[A/G]caataccgcatttcttagaacata
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens) MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- CEBPA_HUMAN CDK8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | 2.63 | n/a | 2.00 | -4.76 | Concordant | |||
| CDK8_HUMAN | 2.77 | -5.29 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Esophagus_Gastroesophageal_Junction, Lung, Spleen, Whole_Blood