rs2428384 chr12:120302874 A>C
- Sequence
gctgggattacgggcacgtgccac[A/C]atgcccggctaattttttttgtat
- ASB for transcription factors
- BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | 3.00 | -4.47 | 1.33 | 0.21 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
