rs2430484 chr7:104941515 G>T
- Sequence
cctcccctgccaccttactgatag[G/T]cttcacttcccagagaactttccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines) macrophages
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -1.75 | 2.31 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Spleen, Whole_Blood