rs2430853 chr18:2656249 G>C
- Sequence
ctcggactacgcgggatttcgcgc[G/C]tgtgtgtgtcaggtacgcgaaggg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.99 | 0.65 | 1.05 | |||
| HEK293 (embryonic kidney) | 1.01 | 0.49 | 2.25 |
Items per page:
1 – 2 of 2