rs2430864 chr12:79738267 A>G
- Sequence
ggatattgttcaaggagtgcctta[A/G]acataggtacatttattgtacata
- ASB in cell types
- KMS-11 (Plasma cell myeloma) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | -2.19 | 1.47 | 2.00 | |||
| PC9 (lung adenocarcinoma) | 1.37 | 0.69 | 2.00 |
Items per page:
1 – 2 of 2