rs2431135 chr5:175382305 G>T
- Sequence
aatcatggcaaacccagctcttaa[G/T]tcagggtggttttccctgtccacc
- ASB in cell types
- Mutu-1 (Epstein-Barr virus-related Burkitt lymphoma)
- ASB for transcription factors
- COE1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE1_HUMAN | 2.63 | -4.96 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), eye color, normoxic and mild-hypoxic adaptation in populations residing at low and moderate altitudes