rs2431401 chr5:156585044 G>C
- Sequence
gacctctcaaagaaatcattgaga[G/C]aaaacagctaaacttagtgaagta
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.04 | -0.19 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 1.40 | -3.93 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Heart_Atrial_Appendage, Lung