rs2431697 chr5:160452971 T>C
- Sequence
ttggtggggctgaaataaaaaacc[T/C]cgatttagaaatctgatacaaaag
- ASB in cell types
- MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.74 | -0.87 | 2.08 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-dsdna autoantibody status in systemic lupus erythematosus (sle) patients, comorbid depressive syndrome and alcohol dependence, eye color, myasthenia gravis, psoriasis, psoriasis (type 1), refractive error, spine bone mineral density (bmd), systemic lupus erythematosus (sle), systemic lupus erythematosus (sle) (females)
PheWAS abnormal papanicolaou smear of cervix and cervical hpv, abnormal thyroid function, acid-base balance disorder, acidosis, adrenal hypofunction, althetes foot, ankylosis of joint, benign neoplasm of colon, chronic lymphocytic thyroiditis, chronic pain syndrome, chronic sinusitis, circumscribed scleroderma, colles fracture, congenital anomalies of genital organs, decreased white blood cell count, decubitus ulcer, dermatophytosis, dermatophytosis / dermatomycosis, dermatophytosis of nail, deviated nasal septum, diseases of the oral soft tissues, eustachian tube disorders, fracture of hand or wrist, fracture of radius and ulna, hemorrhage from gastrointestinal ulcer, herpes zoster with nervous system complications, infection/inflammation of internal prosthetic device, implant or graft, influenza, insect bite, joint effusions, labyrinthitis, large cell lymphoma, muscle weakness, open wound of finger(s), open wounds of extremities, open-angle glaucoma, other disorders of prostate, other disorders of the nervous system, other specified diseases of the salivary glands, other specified gastritis, otitis media, otorrhea, pancreatic cancer, plasma protein metabolism disorder, postoperative infection, primary open angle glaucoma, protein plasma/amino-acid transport and metabolism disorder, pulmonary embolism and infarction, pyogenic arthritis, renal failure nos, secondary malignant neoplasm of liver, sinoatrial node dysfunction, spondylosis with myelopathy, suppurative and unspecified otitis media, type 1 diabetes nephropathy, ulcer of esophagus