rs2432560 chr16:58499805 G>T
- Sequence
tgcatgtctgtgacgaccctgtgt[G/T]tacctgacatgggtgagtctgtac
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 0.51 | 1.22 | 1.14 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, asthma, fasting insulin, homa-ir, maternal transmission distortion, sporadic creutzfeldt-jakob disease, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary