rs2433437 chr11:86743544 G>A
- Sequence
caacagtcaaactctgagccctgc[G/A]taggctgtgaaaactgagtcacag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.84 | -0.07 | 1.46 | |||
| A549 (lung carcinoma) | 1.03 | 0.19 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, rheumatoid arthritis