rs2433438 chr11:86743704 T>C
- Sequence
agagcaggctctggggtaaatggc[T/C]gggaagacttgttgagacaccaaa
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) JB6 (Human anaplastic large cell lymphoma)
- ASB for transcription factors
- EP300_HUMAN RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 1.25 | 0.16 | 1.56 | n/a | n/a | |||
| RFX1_HUMAN | 1.43 | -3.08 | 1.83 | n/a | No Hit |
Items per page:
1 – 2 of 2