rs2434130 chr3:37531199 G>A
- Sequence
tgcccccaggagtgtggctggccc[G/A]ctctgccctcaggaagtttgcttc
- ASB in cell types
- CD34+ hematopoietic stem cells CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- TIF1B_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1B_HUMAN | -5.49 | 3.16 | 2.00 | n/a | n/a | |||
| GATA1_HUMAN | 1.29 | -3.90 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Whole_Blood