rs244729 chr5:177112017 C>G
- Sequence
ggtagaaggaagagttggagggga[C/G]atggtggggcgttgttgccacctg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) erythroid cells epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.18 | 0.91 | 2.01 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.95 | 0.54 | 1.14 | |||
| erythroid cells | 2.31 | n/a | 5.00 | |||
| epidermal keratinocytes | 2.46 | -1.50 | 2.00 | |||
| R3/R4 erythroid cells | 1.95 | -0.37 | 1.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP activated partial thromboplastin time, adiponectin levels, chronic kidney disease, ldl cholesterol, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Uterus, Whole_Blood