rs246227 chr16:16042290 T>C
- Sequence
gttcataaaaggctggtacaggaa[T/C]gttcttagctactttgtgataacc
- ASB in cell types
- 22RV1 (prostate carcinoma) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.18 | 0.57 | 1.00 | -6.96 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, adiponectin levels, advanced age-related macular degeneration, cognitive response of healthy volunteers to topiramate treatment as measure by the digit symbol cognitive test, cognitive response of healthy volunteers to topiramate treatment as measure by the trailsa cognitive test, ldl cholesterol, stabilized warfarin dose, taste change in healthy volunteers in response to topiramate treatment (less carbonation)