rs246882 chr5:157132003 G>A
- Sequence
atatacagctgattaaacagtaga[G/A]ccctaggattctggggtgttttcc
- ASB in cell types
- A549 (lung carcinoma) SK-N-SH (neuroblastoma) bipolar neuron
- ASB for transcription factors
- RAD21_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | -0.03 | 1.58 | 2.00 | n/a | n/a | |||
| SMC3_HUMAN | -0.27 | 1.49 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Coronary, Artery_Tibial, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood