rs2488991 chr1:1059011 G>T
- Sequence
aggagggaggaggacctcggaggg[G/T]aggaggagggtgcgcagaaccagg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 2.28 | 0.23 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1